View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7281_low_14 (Length: 241)
Name: NF7281_low_14
Description: NF7281
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7281_low_14 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 1 - 231
Target Start/End: Complemental strand, 53721336 - 53721107
Alignment:
| Q |
1 |
tgacaaagacacctccgtatgagtagggtagaaggtagatattatccttggacaaattcgaagggcatttcaacttggagttggagttnnnnnnnnggta |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
53721336 |
tgacaaagacacctccgtatgagtagggtagaaggtagatattatccttggacaaattcgaagggcatttcaacttggagttggagttaaaaaaa-ggta |
53721238 |
T |
|
| Q |
101 |
gtaatgaagggtcccttggttaaggcccttgatgcaccattgtcttaaaagtgagcaaaatgttcccttattagcaaacatgtgtgctgttcaatctttg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53721237 |
gtaatgaagggtcccttggttaaggcccttgatgcaccattgtcttaaaagtgagcaaaatgttcccttattagcaaacatgtgtgctgttcaatctttg |
53721138 |
T |
|
| Q |
201 |
ttattttctacccactacttctttactgatg |
231 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
53721137 |
ttattttctacccactacttctttactgatg |
53721107 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University