View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7281_low_16 (Length: 240)
Name: NF7281_low_16
Description: NF7281
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7281_low_16 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 189; Significance: 1e-102; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 13 - 225
Target Start/End: Original strand, 43222930 - 43223141
Alignment:
| Q |
13 |
gtccgcatataatgtcttttttcttataaaacttaatgaaaaatatcttttgttggtagaccctaggtttattagccgtaacccttgtgccggccctaga |
112 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
43222930 |
gtccgcatataatgtctttt-tcttataaaacttaatgaaaaatatcttttgttggtagaccctaggtttattagccataacccttgtgccggccctaga |
43223028 |
T |
|
| Q |
113 |
gaaggctaacaccaaatttcactttcttggcaatcaagtaagcaaaagaaaggtcgatttcgcttttagttagtattggttagtgagttttttagtagat |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43223029 |
gaaggctaacaccaaatttcactttcttggtaatcaagtaagcaaaagaaaggtcaattttgcttttagttagtattggttagtgagttttttagtagat |
43223128 |
T |
|
| Q |
213 |
tcaatttgaaact |
225 |
Q |
| |
|
||||||||||||| |
|
|
| T |
43223129 |
tcaatttgaaact |
43223141 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University