View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7284_high_11 (Length: 368)
Name: NF7284_high_11
Description: NF7284
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7284_high_11 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 66; Significance: 4e-29; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 66; E-Value: 4e-29
Query Start/End: Original strand, 217 - 352
Target Start/End: Original strand, 43536576 - 43536721
Alignment:
| Q |
217 |
gacttagtcaagcatatactaaatgatttgctctctcataatcaatcacctcacttcatc------nnnnnnnnnnnntcacctcaagatagtagctgat |
310 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
43536576 |
gacttagtcaagcatatactaaatgatttgctttctcataatcaatcacctcacttcatcaaaatataaaataaaaaatcacctcaagatagtagctgat |
43536675 |
T |
 |
| Q |
311 |
cttgttcc----atatacgtaagtatatgttgtggttgccatattg |
352 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
43536676 |
cttgttccacatatatacgtaagtatatgttgtggttgccatattg |
43536721 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University