View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7284_low_17 (Length: 309)
Name: NF7284_low_17
Description: NF7284
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7284_low_17 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 221; Significance: 1e-121; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 221; E-Value: 1e-121
Query Start/End: Original strand, 11 - 251
Target Start/End: Complemental strand, 13146513 - 13146273
Alignment:
| Q |
11 |
gagagaagaaatggtacaaatgctcagaattgcattgctttgcacaagcagaaatccagctgatagaccttcaatgagaaaagttgtgtcgatgcttgaa |
110 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |||||| |
|
|
| T |
13146513 |
gagagaagaaatggtacaaatgctcagaattgcattgctttgcacaagcagaaatccagctgatagaccttcaatgagaaaagctgtgtcgatccttgaa |
13146414 |
T |
|
| Q |
111 |
gggattaaatcgaagggggaattacctgatatttttagttttgatgttggtgaaggtagtgctaacaaatattttgatatttgtattagtgtaactaaga |
210 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| ||||| ||||||||||||||| |
|
|
| T |
13146413 |
gggattaaatcgaagggggaattacctgatatttttagttttgatgttggtgaaggtggtgctaacaaatattttgatgtttgtcttagtgtaactaaga |
13146314 |
T |
|
| Q |
211 |
cccggattaagggggtgaacacattttaattttagttaaaa |
251 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13146313 |
cccggattaagggggtgaacacattttaattttagttaaaa |
13146273 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 15 - 107
Target Start/End: Original strand, 13227886 - 13227978
Alignment:
| Q |
15 |
gaagaaatggtacaaatgctcagaattgcattgctttgcacaagcagaaatccagctgatagaccttcaatgagaaaagttgtgtcgatgctt |
107 |
Q |
| |
|
||||||||| ||||||||| ||||||||||||||||||||||| |||||||||||||||||||||||||||||| | ||||||| ||||||| |
|
|
| T |
13227886 |
gaagaaatgaaacaaatgcttagaattgcattgctttgcacaagtagaaatccagctgatagaccttcaatgagagatgttgtgttgatgctt |
13227978 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 30 - 89
Target Start/End: Complemental strand, 13313719 - 13313660
Alignment:
| Q |
30 |
atgctcagaattgcattgctttgcacaagcagaaatccagctgatagaccttcaatgaga |
89 |
Q |
| |
|
||||| ||||||||||||||||||||||||||| || ||| |||| |||||||||||| |
|
|
| T |
13313719 |
atgcttagaattgcattgctttgcacaagcagacatagagccaataggccttcaatgaga |
13313660 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University