View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF7284_low_24 (Length: 224)

Name: NF7284_low_24
Description: NF7284
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF7284_low_24
NF7284_low_24
[»] chr1 (1 HSPs)
chr1 (1-206)||(52878736-52878944)


Alignment Details
Target: chr1 (Bit Score: 191; Significance: 1e-104; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 1 - 206
Target Start/End: Complemental strand, 52878944 - 52878736
Alignment:
1 aaacgacaacaagctagcaagttcaaaaataattaaatatctttccaacttgtt---aaatatatgtgatccatgttgatcacaaacaaataactaaata 97  Q
    |||||||||||||||||||||||||||||||||||||||| |||||||||||||   |||||||||||||||||||||||||||||||||||||||||||    
52878944 aaacgacaacaagctagcaagttcaaaaataattaaatatatttccaacttgttgttaaatatatgtgatccatgttgatcacaaacaaataactaaata 52878845  T
98 actaaaaaattgtaacgaggaagaaaattgtgttagagatccgagaatacaagcaaatagaaggggaagtagaccgagaccaaataactaaaaaatggaa 197  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
52878844 actaaaaaattgtaacgaggaagaaaattgtgttagagatccgagaatacaagcaaatagaaggggaagtagaccgagaccaaataactaaaaaatggaa 52878745  T
198 gcaatggat 206  Q
    |||||||||    
52878744 gcaatggat 52878736  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University