View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7284_low_6 (Length: 428)
Name: NF7284_low_6
Description: NF7284
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7284_low_6 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 127; Significance: 2e-65; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 127; E-Value: 2e-65
Query Start/End: Original strand, 13 - 168
Target Start/End: Complemental strand, 40762961 - 40762806
Alignment:
| Q |
13 |
aaaatagttatccatgtttaannnnnnnggtatataaatttatactctcaatgatcttcttaagaaggagtgtgcataatcttaaacgacatgggattgt |
112 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
40762961 |
aaaatagttatccatgtttaatttttttggtatataaatttatactctcaatgatcttcttaagaaggagcttgcataatcttaaacgacatgggattgt |
40762862 |
T |
|
| Q |
113 |
gacaatataagtacttttctaggccaacatattcaactcacctaaacttttacttg |
168 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40762861 |
gacaatataagtacttttctaggccaacatattcaactcacctaaacttttacttg |
40762806 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 120; E-Value: 3e-61
Query Start/End: Original strand, 226 - 345
Target Start/End: Complemental strand, 40762748 - 40762629
Alignment:
| Q |
226 |
tttcattgcagatgagtaactatcaatcaatcgaaggagttttatactgcaagactcacgctgagcagcttttcaaggattccttcgccgccaagaaacc |
325 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40762748 |
tttcattgcagatgagtaactatcaatcaatcgaaggagttttatactgcaagactcacgctgagcagcttttcaaggattccttcgccgccaagaaacc |
40762649 |
T |
|
| Q |
326 |
ccagacgggtaataagatcc |
345 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
40762648 |
ccagacgggtaataagatcc |
40762629 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University