View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF7285_low_4 (Length: 310)

Name: NF7285_low_4
Description: NF7285
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF7285_low_4
NF7285_low_4
[»] chr8 (1 HSPs)
chr8 (15-184)||(4175964-4176133)
[»] chr4 (1 HSPs)
chr4 (60-184)||(55518567-55518691)
[»] chr2 (1 HSPs)
chr2 (36-118)||(8902901-8902983)


Alignment Details
Target: chr8 (Bit Score: 170; Significance: 3e-91; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 170; E-Value: 3e-91
Query Start/End: Original strand, 15 - 184
Target Start/End: Original strand, 4175964 - 4176133
Alignment:
15 aatgttaaggtggaacacaattgttgcgtgtgtatggtgagggataaaggtgcagcgtttataccatgtggacacacgttttgcaggatgtgttcaagag 114  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
4175964 aatgttaaggtggaacacaattgttgcgtgtgtatggtgagggataaaggtgcagcgtttataccatgtggacacacgttttgcaggatgtgttcaagag 4176063  T
115 agctttgggttagtagagggaattgtcctctttgcaatcattttattttagaagttcttgatattttctg 184  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
4176064 agctttgggttagtagagggaattgtcctctttgcaatcattttattttagaagttcttgatattttctg 4176133  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 37; Significance: 0.000000000007; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 60 - 184
Target Start/End: Original strand, 55518567 - 55518691
Alignment:
60 aaaggtgcagcgtttataccatgtggacacacgttttgcaggatgtgttcaagagagctttgggttagtagagggaattgtcctctttgcaatcatttta 159  Q
    |||||||||||||| ||||| ||||||||||| ||||||||  |||||||||| || || ||| | | | |||| |||||||| ||||| |||| || ||    
55518567 aaaggtgcagcgttcataccgtgtggacacactttttgcagagtgtgttcaagggaactgtggttgaatcgaggaaattgtcccctttgtaatcgttcta 55518666  T
160 ttttagaagttcttgatattttctg 184  Q
    || | ||  |||| |||||||||||    
55518667 ttctcgagattctcgatattttctg 55518691  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 35; Significance: 0.0000000001; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 36 - 118
Target Start/End: Original strand, 8902901 - 8902983
Alignment:
36 tgttgcgtgtgtatggtgagggataaaggtgcagcgtttataccatgtggacacacgttttgcaggatgtgttcaagagagct 118  Q
    ||||| ||||| |||| |||| |||||||||| |||||||| ||||||||||| || ||||||||| | ||||| || |||||    
8902901 tgttgtgtgtgcatggggaggaataaaggtgcggcgtttattccatgtggacatactttttgcagggtttgttctagggagct 8902983  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University