View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7285_low_5 (Length: 278)
Name: NF7285_low_5
Description: NF7285
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7285_low_5 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 217; Significance: 1e-119; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 18 - 259
Target Start/End: Complemental strand, 52734301 - 52734052
Alignment:
| Q |
18 |
aaaccaacaagcatacagtcaccaccaaccaacaagatgttaagaacacgttgttttgaagtaatcctatttttgtggcgatcataagcccttgatacag |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52734301 |
aaaccaacaagcatacagtcaccaccaaccaacaagatgttaagaacacgttgttttgaagtaatcctatttttgtggcgatcataagcccttgatacag |
52734202 |
T |
|
| Q |
118 |
tttttgttgcagctggtgataccaattttgaatgacaaacactgcattctatcatcccattattcgttggtatttgcatcc--------tgatattaatg |
209 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
52734201 |
tttttgttgcagctggtgataccaattttgaatgacagacactgcattctatcatcccattattcgttggtatttgcatcctatatgattgatattaatg |
52734102 |
T |
|
| Q |
210 |
aactcgatctgcaataagaaaataaagatccattgattacgataagtatg |
259 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52734101 |
aactcgatctgcaataagaaaataaagatccattgattacgataagtatg |
52734052 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University