View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7285_low_8 (Length: 250)
Name: NF7285_low_8
Description: NF7285
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7285_low_8 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 208; Significance: 1e-114; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 19 - 250
Target Start/End: Original strand, 2549174 - 2549405
Alignment:
| Q |
19 |
agtgcatgtttgatgtcacaatagatttaagccacatatgtcgctttagcaaaaccacattgacctatcgtaattctaacaagttgattgtgaatctaaa |
118 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||| |||||| |||| |||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
2549174 |
agtgcatgtttgatatcacaatagatttaagccacatatgtcgcttttgcaaaatcacagtgacttatcgtaattctaacaagttgattgtgaatctaaa |
2549273 |
T |
 |
| Q |
119 |
catacatatgaaaccaaagtgttttaagtctaattagagattaagtaccttgttttgagttatctcggcttgaattcctagtatgcctgcaacaatatcc |
218 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2549274 |
catacatatgagaccaaagtgttttaagtctaattagagattaagtaccttgttttgagttatctcggcttgaattcctagtatgcctgcaacaatatcc |
2549373 |
T |
 |
| Q |
219 |
atcaccatgacaagtatgcaaataaggaagcc |
250 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
2549374 |
atcaccatgacaagtatgcaaataaggaagcc |
2549405 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 161 - 220
Target Start/End: Complemental strand, 36573615 - 36573556
Alignment:
| Q |
161 |
aagtaccttgttttgagttatctcggcttgaattcctagtatgcctgcaacaatatccat |
220 |
Q |
| |
|
||||||||| ||||||| ||| || ||||||||||| |||||||| ||||||| |||||| |
|
|
| T |
36573615 |
aagtaccttattttgagctatttctgcttgaattccaagtatgccagcaacaacatccat |
36573556 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University