View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7289_low_11 (Length: 283)
Name: NF7289_low_11
Description: NF7289
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7289_low_11 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 116; Significance: 5e-59; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 116; E-Value: 5e-59
Query Start/End: Original strand, 11 - 126
Target Start/End: Complemental strand, 42658186 - 42658071
Alignment:
| Q |
11 |
cagagagaaaagagttacaatgatcaaagattctgagaaactcttactaggttaaaatttgtagggccatgcttcattgtaatccactttgacataatgg |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42658186 |
cagagagaaaagagttacaatgatcaaagattctgagaaactcttactaggttaaaatttgtagggccatgcttcattgtaatccactttgacataatgg |
42658087 |
T |
 |
| Q |
111 |
cgtgggaagtttgata |
126 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
42658086 |
cgtgggaagtttgata |
42658071 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 106; E-Value: 4e-53
Query Start/End: Original strand, 153 - 266
Target Start/End: Complemental strand, 42658044 - 42657931
Alignment:
| Q |
153 |
cacttcttgctaaattggaaactaccactctctttatttgtttatgaacgaatattagtaattcatcttttggggctaactactatgttcatgtgggaag |
252 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42658044 |
cacttcttgctaaattggaaactaccactctctttatttgtttatgaacgaatattagtaattcatcttttggggctaactactatgttcatgtgggaag |
42657945 |
T |
 |
| Q |
253 |
tccaatgtaaatgt |
266 |
Q |
| |
|
| ||||| |||||| |
|
|
| T |
42657944 |
tgcaatgcaaatgt |
42657931 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University