View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7289_low_14 (Length: 248)
Name: NF7289_low_14
Description: NF7289
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7289_low_14 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 156; Significance: 5e-83; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 156; E-Value: 5e-83
Query Start/End: Original strand, 1 - 207
Target Start/End: Complemental strand, 22364753 - 22364530
Alignment:
| Q |
1 |
tttgctcacaattgtttgaaattaaattattatttggagtctatgcattaaatttgttgccaacattgtgtattgggtctatacatttcattgtgtaaga |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22364753 |
tttgctcacaattgtttgaaattaaattattatttggagtctattcattaaatttgttgccaacattgtgtattgggtctatacatttcattgtgtaaga |
22364654 |
T |
|
| Q |
101 |
gtttatgtttatgatgatgataattg-----------------aaacctcttattcatagttaagagtttgtttgaattgtgaaaatcttgaaacttatg |
183 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22364653 |
gtttatgtttatgatgatgataattgaaatgaaaccatctatcaaacctctaattcatagttaagagtttgtttgaattgtgaaaatcttgaaacttatg |
22364554 |
T |
|
| Q |
184 |
tgtatttaaacaaacttatgaagg |
207 |
Q |
| |
|
||||| |||||||||||||||||| |
|
|
| T |
22364553 |
tgtatctaaacaaacttatgaagg |
22364530 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University