View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7290_high_5 (Length: 348)
Name: NF7290_high_5
Description: NF7290
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7290_high_5 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 304; Significance: 1e-171; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 304; E-Value: 1e-171
Query Start/End: Original strand, 15 - 334
Target Start/End: Complemental strand, 40882954 - 40882635
Alignment:
| Q |
15 |
tatatacatcgttggttgcaattgtcaggcttgagtctttgaagatgaaatttatgtctatattgaaacccattatgagattgctaagcttggcatataa |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40882954 |
tatatacatcgttggttgcaattgtcaggcttgagtctttgaagatgaaatttatgtctatattgaaacccattatgagattgctaagcttggcatataa |
40882855 |
T |
 |
| Q |
115 |
taaatttcattgtgattcaaagatttatgaatcaagtcttacgtgcagatttgagattacatatgttagtctgtcacttgtcgaaaataaaatgttagtc |
214 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40882854 |
taaatttcattgtgattcaaagatttacgaatcaagtcttacgtgcagatttgagattacatatgttagtctgtcacttgtcgaaaataaaatgttagtc |
40882755 |
T |
 |
| Q |
215 |
tgtctgtcctctgtcatgaaaaatatttcagtgatggtaaattgctgtagtatttagccatgaagaatgacagtataaattagcatgcacggttatccaa |
314 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| || |||||||||| |
|
|
| T |
40882754 |
tgtctgtcctctgtcatgaaaaatatttcagtgatggtaaattgctgtagtatttagccatgaagagtgacagtataaattagcatccatggttatccaa |
40882655 |
T |
 |
| Q |
315 |
cacatcattgggtgataatt |
334 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
40882654 |
cacatcattgggtgataatt |
40882635 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University