View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7290_low_11 (Length: 323)
Name: NF7290_low_11
Description: NF7290
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7290_low_11 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 231; Significance: 1e-127; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 231; E-Value: 1e-127
Query Start/End: Original strand, 16 - 295
Target Start/End: Original strand, 47156187 - 47156458
Alignment:
| Q |
16 |
atgagatgatgccaaggaaattgttaacgacaaagcaaattagacactagggaatactcaatttactcatgtgcaaataatcactctgaataaattaatt |
115 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||| ||||||||||||||||||||||||||| | |||||||||||||||||||||| |
|
|
| T |
47156187 |
atgagatgatgccaaggaaattgttaatgacaaagcaaattagacaccagggaatactcaatttactcatgtgcagacaatcactctgaataaattaatt |
47156286 |
T |
|
| Q |
116 |
gattgcctcttcaggaacatatatattacaaaaatatttttctataatatctattagacatttagactatagtctttctttattaatatgacgagattta |
215 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
47156287 |
gattgcctcttcaggaacatatatattacaaaaatatttttctataatatcta--------ttagactatggtctttctttattaatatgacgagattta |
47156378 |
T |
|
| Q |
216 |
gcttatagaaatttgaatcggtggtctctactcagcattcccattgttttttgtgttgttattattcttctgaatttgtc |
295 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47156379 |
gcttatagaaatttgaatcggtggtctctactcagcattcccattgttttttgtgttgttattattcttctgaatttgtc |
47156458 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University