View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7290_low_17 (Length: 272)
Name: NF7290_low_17
Description: NF7290
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7290_low_17 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 238; Significance: 1e-132; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 238; E-Value: 1e-132
Query Start/End: Original strand, 20 - 261
Target Start/End: Original strand, 4467768 - 4468009
Alignment:
| Q |
20 |
gatttgatctccggcagtgattacaagtgcaccttgttcaggacagaaagtcaaccaacttttctttgagtaaacatgaaactctgaagagccatcacac |
119 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4467768 |
gatttgatctcccgcagtgattacaagtgcaccttgttcaggacagaaagtcaaccaacttttctttgagtaaacatgaaactctgaagagccatcacac |
4467867 |
T |
|
| Q |
120 |
acatgcaaacataaagaatgagagtaatcagttcccctaatcagcattctaatcacatcatatttcaaagaatcaacccaatgatcattcctattaatat |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4467868 |
acatgcaaacataaagaatgagagtaatcagttcccctaatcagcattctaatcacatcatatttcaaagaatcaacccaatgatcattcctattaatat |
4467967 |
T |
|
| Q |
220 |
cttgatgatgcttgtaaatgcaacaaagtgtcccaacttcat |
261 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4467968 |
cttgatgatgcttgtaaatgcaacaaagtgtcccaacttcat |
4468009 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University