View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7290_low_18 (Length: 264)
Name: NF7290_low_18
Description: NF7290
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7290_low_18 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 219; Significance: 1e-120; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 13 - 264
Target Start/End: Complemental strand, 40883265 - 40883014
Alignment:
| Q |
13 |
aatattgtgataatgacannnnnnnggatgcagcttttagatgagaaggatcatgatcgtattcttggcccgtacaagaaagttcagcagtggattgaga |
112 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
40883265 |
aatattgtgataatgacatttttttggatgcagcttttagatgagaaggatcatgatcgtattcttggcccgtacaagaaagttcagcagtgggttgaga |
40883166 |
T |
 |
| Q |
113 |
gcacaaaaaatgcaacgaaaccacattttcatgaagttcataatgtcctctataagctcaaattgaggctttcattgaagcaatctagtcagacagatgg |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
40883165 |
gcacaaaaaatgcaacgaaaccacattttcatgaagttcataatgtcctctataagctcaaattgagactttcattgaagcaatctagtcagacagatgg |
40883066 |
T |
 |
| Q |
213 |
ggaaatgaaatctgggattaaagcccctatagcttccaggatgtgattaatc |
264 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
40883065 |
ggaaatgaaatctgggattaaagcccctatagcttcaaggatgtgattaatc |
40883014 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University