View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7290_low_19 (Length: 258)
Name: NF7290_low_19
Description: NF7290
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7290_low_19 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 195; Significance: 1e-106; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 1 - 243
Target Start/End: Complemental strand, 18252117 - 18251875
Alignment:
| Q |
1 |
actaaattaagacatgttattggaaaagtatctaaataaagattctactttgtatactatatagtttgtagctagtgtttaccctccccttctcactagg |
100 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
18252117 |
actaaattgagacatgttattggaaaagtatctaaataaagattctactttgtatgctatatagtttgtagctagtgtttaccctctccttctcactaga |
18252018 |
T |
|
| Q |
101 |
aaatgacaccggtgatttggagtttggtcggaaagcaaattcagtttctcttgaacaatttctcctcgatgctcattaaccatttgtatctaattgcttg |
200 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||| |||||||||||||||||||||||||||||| || |||||||| ||||||||||||| ||| |
|
|
| T |
18252017 |
aaatgacaccggtgatttggagtttggtcagaaagcaaactcagtttctcttgaacaatttctcctcgatacttattaaccacttgtatctaattgtttg |
18251918 |
T |
|
| Q |
201 |
gttattttatatatccatgtcttttctctaccactcttcttat |
243 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||| |||| |
|
|
| T |
18251917 |
gttattttatatatccacgtcttttctctaccactcttgttat |
18251875 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University