View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7291_high_12 (Length: 297)
Name: NF7291_high_12
Description: NF7291
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7291_high_12 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 168; Significance: 5e-90; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 168; E-Value: 5e-90
Query Start/End: Original strand, 80 - 280
Target Start/End: Complemental strand, 55544038 - 55543838
Alignment:
| Q |
80 |
ttgacagcaaccgaaagtaaacaagtttctattttttaattctatagttatattttatggattaaccaatgatttttgacgttatgatgttatttattta |
179 |
Q |
| |
|
|||||||||||||||||||| ||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55544038 |
ttgacagcaaccgaaagtaatcaagtttttattttttaattctatagttatattttatggattaaccaatgatttttgacgttatgatgttatttatttg |
55543939 |
T |
 |
| Q |
180 |
gaccaccttgcatcttcaaagcacctacaatgatggtggtggtggcagcggcnnnnnnncaagatttggtgtgtatgatgggtcataatagaatctgatg |
279 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55543938 |
gaccaccttgcatcttcaaagcacctacaatgatggtggtggtggcagcggcaaaaaaacaagatttggtgtgtatgatgggtcataatagaatctgatg |
55543839 |
T |
 |
| Q |
280 |
g |
280 |
Q |
| |
|
| |
|
|
| T |
55543838 |
g |
55543838 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University