View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF7291_high_7 (Length: 508)

Name: NF7291_high_7
Description: NF7291
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF7291_high_7
NF7291_high_7
[»] scaffold0013 (3 HSPs)
scaffold0013 (391-490)||(102272-102371)
scaffold0013 (60-300)||(102455-102695)
scaffold0013 (225-274)||(105080-105129)
[»] chr4 (3 HSPs)
chr4 (393-490)||(154294-154391)
chr4 (393-490)||(10307770-10307867)
chr4 (393-490)||(100415-100512)
[»] chr7 (1 HSPs)
chr7 (388-488)||(13041209-13041309)
[»] chr8 (3 HSPs)
chr8 (393-485)||(5680972-5681064)
chr8 (393-488)||(5701022-5701117)
chr8 (393-488)||(5731611-5731706)
[»] chr3 (1 HSPs)
chr3 (394-478)||(12143133-12143217)
[»] scaffold0059 (1 HSPs)
scaffold0059 (225-274)||(70519-70568)
[»] chr1 (1 HSPs)
chr1 (101-139)||(39842667-39842707)


Alignment Details
Target: scaffold0013 (Bit Score: 100; Significance: 3e-49; HSPs: 3)
Name: scaffold0013
Description:

Target: scaffold0013; HSP #1
Raw Score: 100; E-Value: 3e-49
Query Start/End: Original strand, 391 - 490
Target Start/End: Complemental strand, 102371 - 102272
Alignment:
391 gaaagatgtggaggctgaagatagcagaaggtgggaataacccatacttattcagtacaaataactttgtgggaagacaaacatgggagtatgatccaga 490  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
102371 gaaagatgtggaggctgaagatagcagaaggtgggaataacccatacttattcagtacaaataactttgtgggaagacaaacatgggagtatgatccaga 102272  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0013; HSP #2
Raw Score: 74; E-Value: 1e-33
Query Start/End: Original strand, 60 - 300
Target Start/End: Complemental strand, 102695 - 102455
Alignment:
60 gcggcaataggaatgactcttttctcgtaacaaacaagctctattttatgtcaaaatcatttttatt--aatcgtaacaaacacgtgtttaatata---- 153  Q
    |||||||||| ||||||||| |||  ||||||||| ||||||||||||| |||||||||||||||||  ||| |||||||| | || |||||||||        
102695 gcggcaatagaaatgactctcttccggtaacaaacgagctctattttatatcaaaatcatttttattgtaatagtaacaaagaggtttttaatatataca 102596  T
154 ggcttgataacctatcttgtacattcctccnnnnnnnnncctaccttgtactaattctaccnnnnnnnnntacctaacttgtactaaaagccacttagtt 253  Q
    ||| |||||||||| ||||||| |||||           ||||||||||||||||||||||         ||| ||||||||||||||||||||||||||    
102595 ggcctgataacctaccttgtactttcct--aaaataaaacctaccttgtactaattctaccaaaaaaa--tacgtaacttgtactaaaagccacttagtt 102500  T
254 tgacagcgtgtgcttaatcccccttaataatacaacaagatataatg 300  Q
    ||||||||||||||||||  |||||||||||||||||| | ||||||    
102499 tgacagcgtgtgcttaat--cccttaataatacaacaaaaaataatg 102455  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0013; HSP #3
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 225 - 274
Target Start/End: Complemental strand, 105129 - 105080
Alignment:
225 acctaacttgtactaaaagccacttagtttgacagcgtgtgcttaatccc 274  Q
    ||||||||||||||||||| |||||| ||| ||||||| |||||| ||||    
105129 acctaacttgtactaaaagtcacttaattttacagcgtatgcttattccc 105080  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 74; Significance: 1e-33; HSPs: 3)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 74; E-Value: 1e-33
Query Start/End: Original strand, 393 - 490
Target Start/End: Original strand, 154294 - 154391
Alignment:
393 aagatgtggaggctgaagatagcagaaggtgggaataacccatacttattcagtacaaataactttgtgggaagacaaacatgggagtatgatccaga 490  Q
    |||||||||| ||||||||||||||||||||||||| | |||||||||||||| |||||||  |||||||||||||||||||||||||||||||||||    
154294 aagatgtggaagctgaagatagcagaaggtgggaatgagccatacttattcagcacaaatagttttgtgggaagacaaacatgggagtatgatccaga 154391  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 58; E-Value: 4e-24
Query Start/End: Original strand, 393 - 490
Target Start/End: Complemental strand, 10307867 - 10307770
Alignment:
393 aagatgtggaggctgaagatagcagaaggtgggaataacccatacttattcagtacaaataactttgtgggaagacaaacatgggagtatgatccaga 490  Q
    |||||||||| ||||||||||||||||||||||||| |||||||||||||||| ||||| || | |||||| || ||||||||||| || ||||||||    
10307867 aagatgtggaagctgaagatagcagaaggtgggaatgacccatacttattcagcacaaacaattctgtggggagccaaacatgggaataggatccaga 10307770  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #3
Raw Score: 54; E-Value: 9e-22
Query Start/End: Original strand, 393 - 490
Target Start/End: Original strand, 100415 - 100512
Alignment:
393 aagatgtggaggctgaagatagcagaaggtgggaataacccatacttattcagtacaaataactttgtgggaagacaaacatgggagtatgatccaga 490  Q
    |||||||||| ||||||||| | ||| ||   |||| | |||||||||||||| |||||||| |||||||||||||||||||||||||||||||||||    
100415 aagatgtggaagctgaagattggagagggaaagaatgagccatacttattcagcacaaataattttgtgggaagacaaacatgggagtatgatccaga 100512  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 65; Significance: 2e-28; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 65; E-Value: 2e-28
Query Start/End: Original strand, 388 - 488
Target Start/End: Original strand, 13041209 - 13041309
Alignment:
388 aaagaaagatgtggaggctgaagatagcagaaggtgggaataacccatacttattcagtacaaataactttgtgggaagacaaacatgggagtatgatcc 487  Q
    ||||||||||||||||| ||||||||||||| ||||| ||| |||||||| ||||||| ||||| |||||||| |||||||||| |||||||||||||||    
13041209 aaagaaagatgtggaggttgaagatagcagatggtggtaatgacccatacatattcagcacaaacaactttgtaggaagacaaatatgggagtatgatcc 13041308  T
488 a 488  Q
    |    
13041309 a 13041309  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 57; Significance: 1e-23; HSPs: 3)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 393 - 485
Target Start/End: Complemental strand, 5681064 - 5680972
Alignment:
393 aagatgtggaggctgaagatagcagaaggtgggaataacccatacttattcagtacaaataactttgtgggaagacaaacatgggagtatgat 485  Q
    |||||||||||||||||||||||||| ||||||||  | |||||| ||||||||||||||||||||||||| || || |||||||||| ||||    
5681064 aagatgtggaggctgaagatagcagatggtgggaaggatccatacatattcagtacaaataactttgtggggaggcagacatgggagtttgat 5680972  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 393 - 488
Target Start/End: Complemental strand, 5701117 - 5701022
Alignment:
393 aagatgtggaggctgaagatagcagaaggtgggaataacccatacttattcagtacaaataactttgtgggaagacaaacatgggagtatgatcca 488  Q
    |||||||||||||||||||||||||| || |||||| | |||||| |||||||||||||||||||| | || || || |||||||||| |||||||    
5701117 aagatgtggaggctgaagatagcagatggggggaatgatccatacatattcagtacaaataactttttagggaggcagacatgggagtttgatcca 5701022  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #3
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 393 - 488
Target Start/End: Complemental strand, 5731706 - 5731611
Alignment:
393 aagatgtggaggctgaagatagcagaaggtgggaataacccatacttattcagtacaaataactttgtgggaagacaaacatgggagtatgatcca 488  Q
    |||||||||||||||||||||||||| || |||||| | ||| || |||||||||||||||||||| | || || || |||||||||| |||||||    
5731706 aagatgtggaggctgaagatagcagatggggggaatgatccacacatattcagtacaaataactttttagggaggcagacatgggagtttgatcca 5731611  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 45; Significance: 2e-16; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 394 - 478
Target Start/End: Complemental strand, 12143217 - 12143133
Alignment:
394 agatgtggaggctgaagatagcagaaggtgggaataacccatacttattcagtacaaataactttgtgggaagacaaacatggga 478  Q
    ||||||||||||| ||||||||||| ||||||||  |||| ||| ||||||  |||||||||||||| |||||||| ||||||||    
12143217 agatgtggaggcttaagatagcagatggtgggaaggacccttacatattcaccacaaataactttgtaggaagacagacatggga 12143133  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0059 (Bit Score: 38; Significance: 0.000000000003; HSPs: 1)
Name: scaffold0059
Description:

Target: scaffold0059; HSP #1
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 225 - 274
Target Start/End: Original strand, 70519 - 70568
Alignment:
225 acctaacttgtactaaaagccacttagtttgacagcgtgtgcttaatccc 274  Q
    ||||||||||||||||||| |||||||||||||||||| |||||| ||||    
70519 acctaacttgtactaaaagtcacttagtttgacagcgtatgcttattccc 70568  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 30; Significance: 0.0000002; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 101 - 139
Target Start/End: Complemental strand, 39842707 - 39842667
Alignment:
101 tattttatgtcaaaatcattttta--ttaatcgtaacaaac 139  Q
    ||||||||||||||||||||||||  |||||||||||||||    
39842707 tattttatgtcaaaatcatttttattttaatcgtaacaaac 39842667  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University