View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7291_low_14 (Length: 287)
Name: NF7291_low_14
Description: NF7291
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7291_low_14 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 252; Significance: 1e-140; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 252; E-Value: 1e-140
Query Start/End: Original strand, 18 - 269
Target Start/End: Original strand, 36764308 - 36764559
Alignment:
| Q |
18 |
tcacaagcagcgatatgaagagcagtacggccatcaagatcaatgctattaacatcaattccttcgttaagcaaatcctcaacccctttaacatcaccac |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36764308 |
tcacaagcagcgatatgaagagcagtacggccatcaagatcaatgctattaacatcaattccttcgttaagcaaatcctcaacccctttaacatcaccac |
36764407 |
T |
 |
| Q |
118 |
gacacgccatgaagagaagctgcatggtggaatcgagattctccggtacggtgagttccgcctggtcttcatcatcacctggactccgtcggatcgggtc |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36764408 |
gacacgccatgaagagaagctgcatggtggaatcgagattctccggtacggtgagttccgcctggtcttcatcatcacctggactccgtcggatcgggtc |
36764507 |
T |
 |
| Q |
218 |
cagcgatgattgacgaccgaagctgaatcggagattgttccgacgtggatcg |
269 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36764508 |
cagcgatgattgacgaccgaagctgaatcggagattgttccgacgtggatcg |
36764559 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University