View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7291_low_15 (Length: 261)
Name: NF7291_low_15
Description: NF7291
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7291_low_15 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 224; Significance: 1e-123; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 224; E-Value: 1e-123
Query Start/End: Original strand, 19 - 261
Target Start/End: Original strand, 33522520 - 33522762
Alignment:
| Q |
19 |
ccgacaattaccacatcacatttcactttgaggatgttgctattagcatctatatcaatttcaa-acctttattggaaagagattgtgccagactcaaat |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
33522520 |
ccgacaattaccacatcacatttcactttgaggatgttgctattagcatctatatcaatttcaagacctttattggaaagagattgtgccagactcaaat |
33522619 |
T |
 |
| Q |
118 |
catcctcattcatagcttccactattcccttttcaagaggcctctctttttgaatattacttgtgttctcatcattgtcaacatgataaccaatggcttc |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
33522620 |
catcctcattcatagcttccactattcccttttcaagaggcctctctttttgaatattacttgtgctctcatcattgtcaacatgataaccaatggcttc |
33522719 |
T |
 |
| Q |
218 |
ccatgcttggtttttcaccattctcatcatactgcatgcataca |
261 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
33522720 |
ccatgcttgg-ttttcaccattctcatcatactgcatgcataca |
33522762 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University