View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7291_low_18 (Length: 239)
Name: NF7291_low_18
Description: NF7291
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7291_low_18 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 81; Significance: 3e-38; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 81; E-Value: 3e-38
Query Start/End: Original strand, 18 - 119
Target Start/End: Complemental strand, 33523049 - 33522942
Alignment:
| Q |
18 |
cttttttaacatattttggctttagatcaaaaagatattgtattataaaact------catatggtagggaccaaacatattctggaagaatttgcaaca |
111 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33523049 |
cttttttaacatattttggctttagatcaaaaagatattgtcttataaaactcataatcatatggtagggaccaaacatattctggaagaatttgcaaca |
33522950 |
T |
|
| Q |
112 |
aagcaaga |
119 |
Q |
| |
|
|||||||| |
|
|
| T |
33522949 |
aagcaaga |
33522942 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 56; E-Value: 2e-23
Query Start/End: Original strand, 184 - 239
Target Start/End: Complemental strand, 33522877 - 33522822
Alignment:
| Q |
184 |
caatggtgatcttgtgtgattgcctgcttgtattttcaatgtgacattaaaggttt |
239 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33522877 |
caatggtgatcttgtgtgattgcctgcttgtattttcaatgtgacattaaaggttt |
33522822 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University