View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7291_low_20 (Length: 220)
Name: NF7291_low_20
Description: NF7291
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7291_low_20 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 136; Significance: 4e-71; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 136; E-Value: 4e-71
Query Start/End: Original strand, 66 - 205
Target Start/End: Original strand, 15081927 - 15082066
Alignment:
| Q |
66 |
ttgttgaaaccataaatcataataacataccagttatatagaccattgaaattattgttattttcacaatattttaagatcatgctagttatagtataaa |
165 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15081927 |
ttgttgcaaccataaatcataataacataccagttatatagaccattgaaattattgttattttcacaatattttaagatcatgctagttatagtataaa |
15082026 |
T |
|
| Q |
166 |
tttttcagtttcacatttctctcaactctctcacgggttt |
205 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15082027 |
tttttcagtttcacatttctctcaactctctcacgggttt |
15082066 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 5 - 72
Target Start/End: Original strand, 15081834 - 15081903
Alignment:
| Q |
5 |
tgcataaccattaggaatttat--caatatgaatatagttatttgatgtttgttaatttttgtttgttga |
72 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||||| |||| |
|
|
| T |
15081834 |
tgcataaccattaggaatttatatcaatatgaatatagttatttgatgtttgttattttttgttttttga |
15081903 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University