View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7291_low_9 (Length: 378)
Name: NF7291_low_9
Description: NF7291
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7291_low_9 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 322; Significance: 0; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 322; E-Value: 0
Query Start/End: Original strand, 19 - 368
Target Start/End: Complemental strand, 10389180 - 10388831
Alignment:
| Q |
19 |
tcaattgagtagtaatttagagcctcttgaacttggcctttgttacggatgtcaatgtctcttgattgtactaatgctgaatgaagaaatacattatgtg |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
10389180 |
tcaattgagtagtaatttagagcctcttgaacttggcctttgttacggatgtcaatgtctcttgattgtactaatgctgaatgaagaaacacattatgtg |
10389081 |
T |
 |
| Q |
119 |
gagttataacacatcctacaatttccactgcttgacgaagcgtttttgagctaactcttgggatcaaaagacctacaaggaagtattacatatgttaaat |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
10389080 |
gagttataacacatcctacaatttccactgcttgacgaagcgtttttgagctaactcttgggatcaaaagacctacaaggaagtattaaatatgttaaat |
10388981 |
T |
 |
| Q |
219 |
aaatgtactagtattggaaataacgtagcaccgtcactttagtttggagacgtgttcggtgtttgatatgtgtcagtatccaacacaaacatgacaacaa |
318 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||| |||||||||||||||||| |||||||||||||||||| |
|
|
| T |
10388980 |
aaatgtactagtattggaaataacgtagcaccgtcactttagtttggagacgtatttggtgtctgatatgtgtcagtatccgacacaaacatgacaacaa |
10388881 |
T |
 |
| Q |
319 |
cacatgttttattgaaaattattattagtatcatgtctggcgtgtgtgcg |
368 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
10388880 |
cacatgttttattgaaaattattattagtatcatgtctggtgtgtgtgcg |
10388831 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University