View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7292_low_12 (Length: 303)
Name: NF7292_low_12
Description: NF7292
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7292_low_12 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 253; Significance: 1e-141; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 253; E-Value: 1e-141
Query Start/End: Original strand, 18 - 290
Target Start/End: Original strand, 29135215 - 29135487
Alignment:
| Q |
18 |
attttgataggccacttctagatcaccaaaatcaaacctgctaacattgttagtgttaatatttttcatatcaaaattcacaatatttgtcaagttatat |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||| |
|
|
| T |
29135215 |
attttgataggccacttctagatcaccaaaatcaaacctgctaacattgttagtgttaatatttttcatatcaaaattcacaatatctttcaagttatat |
29135314 |
T |
|
| Q |
118 |
atatggtgatttcatcttctaattcttcactactacaatgtgaatcatcatcaccatccaccccactatccccttctcctttaccatcatcatattcatc |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |||||||||||||||||| |
|
|
| T |
29135315 |
atatggtgatttcatcttctaattcttcactactacaatgtgaatcatcatcaccatccaccccactatcccctgctccttcaccatcatcatattcatc |
29135414 |
T |
|
| Q |
218 |
ctcaccaccatcttcaccctcaacgtcatactgactactatcacctccatcaccgtcttcattctcaccacca |
290 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29135415 |
ctcaccaccatcttcaccctcaacgtcatactgaccactatcacctccatcaccgtcttcattctcaccacca |
29135487 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University