View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7292_low_16 (Length: 255)
Name: NF7292_low_16
Description: NF7292
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7292_low_16 |
 |  |
|
| [»] chr6 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 196; Significance: 1e-107; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 196; E-Value: 1e-107
Query Start/End: Original strand, 13 - 255
Target Start/End: Complemental strand, 8293217 - 8292976
Alignment:
| Q |
13 |
agcagagagaagcagaatttgcaaccagacttttcccattgatttatatacatggatcaccttcattgaaattcatgtataacaaatttttctttgcaca |
112 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
8293217 |
agcagagagaagcagaatttgcaactagacttttcccattgatttatatacatggatcaccttcattgaa-ttcatgtataacaaatttttctttgcaca |
8293119 |
T |
 |
| Q |
113 |
tatgtacgtaaccaattaattcttgtttgtgaaattttcggttattttgaatnnnnnnnnncaacggctgaattgcatgttcttgtatttgcagtttcta |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
8293118 |
tatgtacgtaaccaattaattcttgtttgtgaaattttcggttattatgaataaaaaaaaacaacggctgaattgcatgttcttgtatttacagtttcta |
8293019 |
T |
 |
| Q |
213 |
gtacacatatacagaagattatttcccatgtaaatacatatat |
255 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8293018 |
gtacacatatacagaagattatttcccatgtaaatacatatat |
8292976 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University