View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7292_low_18 (Length: 248)
Name: NF7292_low_18
Description: NF7292
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7292_low_18 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 184; Significance: 1e-99; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 1 - 236
Target Start/End: Original strand, 14394550 - 14394786
Alignment:
| Q |
1 |
caaaataggtcaacgtaatttaacaaaagttacatgcttcgaacaaaatcatgatgtcaccgcaatttatctaaactcactaacaaattttattttaaat |
100 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |||| ||| ||||||||||||||||| ||||||||| |
|
|
| T |
14394550 |
caaaataggtcaatgtaatttaacaaaagttacatgcttcgaacaaaatcatgatgtcaccgcgatttctcttaactcactaacaaatttaattttaaat |
14394649 |
T |
|
| Q |
101 |
cgaatctgcaaataaatattgagacaacatcaaaataaaatgtagatgatgtagtctcaatctttgttgcaagaacataataatt-nnnnnnnttatggt |
199 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
14394650 |
cgaatctgcaaataaatattgagacaacatcaaaataaaatgtggatgatgtagtctcaatctttgttgcaagaacataataattaaaaaaaattatggt |
14394749 |
T |
|
| Q |
200 |
attaccacttagattaatcgtacttcagttgcatatt |
236 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14394750 |
attaccacttagattaatcgtacttcagttgcatatt |
14394786 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University