View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7293_high_11 (Length: 391)
Name: NF7293_high_11
Description: NF7293
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7293_high_11 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 341; Significance: 0; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 341; E-Value: 0
Query Start/End: Original strand, 17 - 381
Target Start/End: Complemental strand, 32376412 - 32376048
Alignment:
| Q |
17 |
cagtatatgcaaggttacccgaaattgaagggaatgatagggaaggagactctgaatcagacgtagaagatgttgatgataacacgggtttgaaatccgg |
116 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
32376412 |
cagtatatgcaaggttacctgaaattgaagggaatgatagggaaggagattctgaatcagacgtagaagatgttgatgataacgcgggtttgaaatccgg |
32376313 |
T |
 |
| Q |
117 |
ttatggcgttcgtgccgcgattgatatatttcattttctctgttctttgttgaatgttgtttctgtagttgaggcagatggatcaactactcatacagct |
216 |
Q |
| |
|
|||||| ||||||||||| |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32376312 |
ttatggtgttcgtgccgcaattgatatatttcattttctgtgttctttgttgaatgttgtttctgtagttgaggcagatggatcaactactcatacagct |
32376213 |
T |
 |
| Q |
217 |
gatgaagatgttcagatttttgctttggttttgattaactcagctattgaattgagtggtgataagatagggaatcaccctaaacttttgaggatggtcc |
316 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32376212 |
gatgaagatgttcagatttttgctttggttttgattaactcagctattgaattgagtggtgataagatagggaatcaccctaaacttttgaggatggtcc |
32376113 |
T |
 |
| Q |
317 |
aagatgatttgtttcatcatttgatttactatggaacttggtctagttcatttgtcttgtctatg |
381 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32376112 |
aagatgatttgtttcatcatttgatttactatggaacttggtctagttcatttgtcttgtctatg |
32376048 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University