View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7293_high_15 (Length: 325)
Name: NF7293_high_15
Description: NF7293
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7293_high_15 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 113; Significance: 3e-57; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 113; E-Value: 3e-57
Query Start/End: Original strand, 1 - 217
Target Start/End: Complemental strand, 25778299 - 25778078
Alignment:
| Q |
1 |
gtttgtttttgttgatttctccctattgttt--gtagtcctatgtattcacggttgatatcactagcaatccttagctatttcaacaagttttattttta |
98 |
Q |
| |
|
|||||||| |||||||| |||||| |||||| ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
25778299 |
gtttgtttctgttgattgctccctgttgtttttgtagtcctatgtattcacggttgatatcactagcaatccttagctatctcaacaagttttattttta |
25778200 |
T |
|
| Q |
99 |
tcatataatatatag--tannnnnnnnnnggttacaatagtatgtgtcaataagttcataaatatcctcccaa-nnnnnnncttcataaatatcctcttc |
195 |
Q |
| |
|
|||||||||||||| || ||||||||||||||||||||||||||||| ||||||||||||| ||||||||||||||||||| |
|
|
| T |
25778199 |
ccatataatatatagtatatttttttttttgttacaatagtatgtgtcaataagttcattaatatcctcccaattttttttcttcataaatatcctcttc |
25778100 |
T |
|
| Q |
196 |
taaactattaaaaagaaatatc |
217 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
25778099 |
taaactattaaaaagaaatatc |
25778078 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University