View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7293_low_29 (Length: 238)
Name: NF7293_low_29
Description: NF7293
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7293_low_29 |
 |  |
|
| [»] chr5 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 103; Significance: 2e-51; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 103; E-Value: 2e-51
Query Start/End: Original strand, 96 - 238
Target Start/End: Original strand, 17154846 - 17154988
Alignment:
| Q |
96 |
ttagggtactttgatctttttagacgtggaaaaacannnnnnnnaagtgtaaataacaattttcaaacttgtttgatgaatgaacccaataaggcccaat |
195 |
Q |
| |
|
|||||||| |||||||||||||||||||| |||||| |||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
17154846 |
ttagggtattttgatctttttagacgtgggaaaacatttttttgaagtgtaaataacaattttcaaacttgtttgatgaaggaacccaataaggcccaat |
17154945 |
T |
 |
| Q |
196 |
acttgctcgtgaaatattattttcgtaatcaatataaaaggtc |
238 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
17154946 |
acttgctcgtgaaatattattttcctaatcaatataaaaggtc |
17154988 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 4 - 67
Target Start/End: Original strand, 17154786 - 17154849
Alignment:
| Q |
4 |
attgctctcccacaccttcaataccccaacgacaattaattgtccttatctccttaacatttag |
67 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||| |||| |||||||||||||||||||||||| |
|
|
| T |
17154786 |
attgctctcccacaccttcaataccccaacaacagttaactgtccttatctccttaacatttag |
17154849 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University