View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF7293_low_33 (Length: 212)

Name: NF7293_low_33
Description: NF7293
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF7293_low_33
NF7293_low_33
[»] chr5 (1 HSPs)
chr5 (19-192)||(30356348-30356521)


Alignment Details
Target: chr5 (Bit Score: 170; Significance: 2e-91; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 170; E-Value: 2e-91
Query Start/End: Original strand, 19 - 192
Target Start/End: Original strand, 30356348 - 30356521
Alignment:
19 agctttgttaggaagatgatgttggagggtttgtgttgaacatgatagtttgtgactgaaggagggaggatgagggaggctgggcgtggtgagtctgtgt 118  Q
    ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
30356348 agctttgttaggaagatgacgttggagggtttgtgttgaacatgatagtttgtgactgaaggagggaggatgagggaggctgggcgtggtgagtctgtgt 30356447  T
119 ggtggaggaatgttaagggtctgcatagaggggagggcttgacaatatgaagatgatttaacgacaacttggtg 192  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
30356448 ggtggaggaatgttaagggtctgcatagaggggagggcttgacaatatgaagatgatttaacgacaacttggtg 30356521  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University