View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7293_low_33 (Length: 212)
Name: NF7293_low_33
Description: NF7293
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7293_low_33 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 170; Significance: 2e-91; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 170; E-Value: 2e-91
Query Start/End: Original strand, 19 - 192
Target Start/End: Original strand, 30356348 - 30356521
Alignment:
| Q |
19 |
agctttgttaggaagatgatgttggagggtttgtgttgaacatgatagtttgtgactgaaggagggaggatgagggaggctgggcgtggtgagtctgtgt |
118 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30356348 |
agctttgttaggaagatgacgttggagggtttgtgttgaacatgatagtttgtgactgaaggagggaggatgagggaggctgggcgtggtgagtctgtgt |
30356447 |
T |
 |
| Q |
119 |
ggtggaggaatgttaagggtctgcatagaggggagggcttgacaatatgaagatgatttaacgacaacttggtg |
192 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30356448 |
ggtggaggaatgttaagggtctgcatagaggggagggcttgacaatatgaagatgatttaacgacaacttggtg |
30356521 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University