View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7294_low_24 (Length: 290)
Name: NF7294_low_24
Description: NF7294
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7294_low_24 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 118; Significance: 3e-60; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 118; E-Value: 3e-60
Query Start/End: Original strand, 120 - 268
Target Start/End: Complemental strand, 41161535 - 41161378
Alignment:
| Q |
120 |
gtcccccctcattataaataacccaatcataatacctccttagccaacactttttgtttgccaatattttcttgca---------aaagacagagaccat |
210 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||||||||||| |
|
|
| T |
41161535 |
gtccaccctcattataaataacccaatcataatacctccttagccaacactttttgtttgccaatattttctttcattttcttgcaaagacagagaccat |
41161436 |
T |
|
| Q |
211 |
ggaataccctctcggttctatattcagttatcaagaagtgagtcattgcattcataat |
268 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41161435 |
ggaataccctctcggttctatattcagttatcaagaagtgagtcattgcattcataat |
41161378 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 111; E-Value: 5e-56
Query Start/End: Original strand, 15 - 125
Target Start/End: Complemental strand, 41161688 - 41161578
Alignment:
| Q |
15 |
ataagaccaaatagaatcaggaaactccaaatttcgctctgcaaggtttgggatttttatattttcattaatatggtcaaggttcttttttatgttggtg |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41161688 |
ataagaccaaatagaatcaggaaactccaaatttcgctctgcaaggtttgggatttttatattttcattaatatggtcaaggttcttttttatgttggtg |
41161589 |
T |
|
| Q |
115 |
agaaagtcccc |
125 |
Q |
| |
|
||||||||||| |
|
|
| T |
41161588 |
agaaagtcccc |
41161578 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University