View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7294_low_26 (Length: 273)
Name: NF7294_low_26
Description: NF7294
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7294_low_26 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 235; Significance: 1e-130; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 235; E-Value: 1e-130
Query Start/End: Original strand, 1 - 254
Target Start/End: Complemental strand, 36033742 - 36033488
Alignment:
| Q |
1 |
tttgtttcttgatgatcaagaggtgagtagttcgggattcttatcgtttctaggtggagctgctgctgctaacgccgcgattcaacgcgtgtaattggcg |
100 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
36033742 |
tttgtttcttgatgatcaggaggtgagtagttcgggattcttatcgtttctaggtggagctgctgctgctaacgccgcgattcaacgcgtgtgattggcg |
36033643 |
T |
|
| Q |
101 |
ggatctgtgatttggtggagttttctattatgaggttggttgaattgaaattgaaattgttgcagatt-ttttgattagatccaaagctaattgcttagg |
199 |
Q |
| |
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
36033642 |
gtatctgtgatttggtggagttttctattatgaggttggttgaattgaaattgaaattgttgcagattcttttgattagatccaaagctaattgcttagg |
36033543 |
T |
|
| Q |
200 |
gtttatagttatgtgatattttttatgctaagagattattgtactatttattaat |
254 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36033542 |
gtttatagttatgtgatattttttatgctaagagattattgtactatttattaat |
36033488 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University