View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7294_low_28 (Length: 256)
Name: NF7294_low_28
Description: NF7294
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7294_low_28 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 176; Significance: 7e-95; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 176; E-Value: 7e-95
Query Start/End: Original strand, 13 - 237
Target Start/End: Original strand, 25100423 - 25100649
Alignment:
| Q |
13 |
aatattaattctaataagaaacaacaatttaaaattgtgtaaaatagttggagttatcatgttattatggataggaagttgttacatgttaccgtcgttt |
112 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
25100423 |
aatattaattctaataagaaacaacaatttaaaattgtgtaaaatagttggagttatcatgttattatggataagaagttgttacatgttaccgtcgttt |
25100522 |
T |
 |
| Q |
113 |
attaatgtcttatcttcggt--agaaaacatgtgagttacataaggtgggttcgcttcttcaaccccaattttctccataaaacttaattttgggaatga |
210 |
Q |
| |
|
||||||| |||||||||| | | ||||||||||||| |||||||||| ||||||||||| |||| |||||||||||||||||||||||||||| ||||| |
|
|
| T |
25100523 |
attaatgacttatcttcgataaaaaaaacatgtgagtcacataaggtgagttcgcttctttaacctcaattttctccataaaacttaattttggaaatga |
25100622 |
T |
 |
| Q |
211 |
acttaattttataagagagctagcaat |
237 |
Q |
| |
|
||||||||||||||||| ||||||||| |
|
|
| T |
25100623 |
acttaattttataagagtgctagcaat |
25100649 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University