View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF7294_low_32 (Length: 248)

Name: NF7294_low_32
Description: NF7294
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF7294_low_32
NF7294_low_32
[»] chr4 (2 HSPs)
chr4 (37-112)||(29751767-29751842)
chr4 (182-230)||(29751914-29751961)


Alignment Details
Target: chr4 (Bit Score: 76; Significance: 3e-35; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 76; E-Value: 3e-35
Query Start/End: Original strand, 37 - 112
Target Start/End: Original strand, 29751767 - 29751842
Alignment:
37 gtgattaaaccctagagcgagagtggagtgaatgaacagtgacaaaaaccctagactcgctcggactggagattct 112  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
29751767 gtgattaaaccctagagcgagagtggagtgaatgaacagtgacaaaaaccctagactcgctcggactggagattct 29751842  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 182 - 230
Target Start/End: Original strand, 29751914 - 29751961
Alignment:
182 agttaagaataataggtatttatagggataaagaatgaaggggacaaag 230  Q
    ||||||||||||| |||||||||||||||||||||||||||||||||||    
29751914 agttaagaataat-ggtatttatagggataaagaatgaaggggacaaag 29751961  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University