View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7294_low_33 (Length: 245)
Name: NF7294_low_33
Description: NF7294
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7294_low_33 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 151; Significance: 5e-80; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 151; E-Value: 5e-80
Query Start/End: Original strand, 56 - 235
Target Start/End: Complemental strand, 40196363 - 40196184
Alignment:
| Q |
56 |
aaaaagttccaacatttagctgtnnnnnnnttaatacttgcagaattatccattgatgctgccttcattgcatctttgaaaaatggtgtagtagacaact |
155 |
Q |
| |
|
||||||||||||||||||||||| ||||||| ||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40196363 |
aaaaagttccaacatttagctgtaaaaaaattaatacctgcagaattattcattgatgctgccttcattgcatctttgaaaaatggtgtagtagacaact |
40196264 |
T |
|
| Q |
156 |
tcactttcgtatgtaaggtgagctgttgctgctggtgttggagctttcaaaaggttttgatcatttcagagttcgttctt |
235 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40196263 |
tcactttcgtatgtaaggtgagctgttgctgctggtgttggagctttcaaaaggttttgatcatttcagagttcgttctt |
40196184 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 18 - 72
Target Start/End: Complemental strand, 40196428 - 40196374
Alignment:
| Q |
18 |
cccacaaggcacaattaattatgatatatttacagcgtaaaaagttccaacattt |
72 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40196428 |
cccacaaggcacaattaattatgatatatttacagcgtaaaaagttccaacattt |
40196374 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University