View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7294_low_35 (Length: 240)
Name: NF7294_low_35
Description: NF7294
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7294_low_35 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 130; Significance: 2e-67; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 130; E-Value: 2e-67
Query Start/End: Original strand, 18 - 172
Target Start/End: Original strand, 31075918 - 31076072
Alignment:
| Q |
18 |
ggttaaactcgtgaaattttcacatttaatacgttttatatttaattctatgtttttattcaataaaaacaattatcctatgacactttgaattggtaaa |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31075918 |
ggttaaactcgtgaaattttcacatttaatacgttttatatttaattctatgtttttattcaataaaaacaattatcctatgacactttgaattggtaaa |
31076017 |
T |
 |
| Q |
118 |
taaataagnnnnnnngaaggaggtaaataaataagttgtcacatcttcaatgcat |
172 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
31076018 |
taaataagtttttttgaaggaggtaaataaataagttgtcacatctttaatgcat |
31076072 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University