View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF7294_low_38 (Length: 231)

Name: NF7294_low_38
Description: NF7294
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF7294_low_38
NF7294_low_38
[»] chr5 (1 HSPs)
chr5 (1-222)||(22364301-22364522)


Alignment Details
Target: chr5 (Bit Score: 206; Significance: 1e-113; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 206; E-Value: 1e-113
Query Start/End: Original strand, 1 - 222
Target Start/End: Original strand, 22364301 - 22364522
Alignment:
1 acatgagaaatgtgtttgtaatgatggtattcattccaagccatccaaacaattgaaacctacggtttgaagaaagaaaagaaaaggagtatgtcttaga 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||    
22364301 acatgagaaatgtgtttgtaatgatggtattcattccaagccatccaaacaattgaaacctacagtttgaagaaagaaaagaaaaggagtatgtcttaga 22364400  T
101 gctgagatacaattgcatgatcacttaataaaaatacggaccccatgcaaaatattgcatgaccggtttatgtaatggagtgttgtacattgtaaatgat 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |||||||||||||||||||||||||||||||||||||    
22364401 gctgagatacaattgcatgatcacttaataaaaatacggaccccatgcaaactattgcatgatcggtttatgtaatggagtgttgtacattgtaaatgat 22364500  T
201 cgaatattatcgtggggtggaa 222  Q
    | ||||||||||||||||||||    
22364501 ctaatattatcgtggggtggaa 22364522  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University