View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7295_high_2 (Length: 327)
Name: NF7295_high_2
Description: NF7295
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7295_high_2 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 206; Significance: 1e-112; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 206; E-Value: 1e-112
Query Start/End: Original strand, 1 - 210
Target Start/End: Original strand, 43055386 - 43055595
Alignment:
| Q |
1 |
ttgatttgttcttatttgtaatttgttggtgtttgttttgttttgattattagttcaagcctgaggagataaatgctatcaataaagacttcgatgagcc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43055386 |
ttgatttgttcttatttgtaatttgttggtgtttgttttgtttttattattagttcaagcctgaggagataaatgctatcaataaagacttcgatgagcc |
43055485 |
T |
 |
| Q |
101 |
tggaactcttgctccaactggattacatattggtggtactaaatatatggtgattcaaggtgaacctggagctgtcattcgagggaagaaggtatatact |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43055486 |
tggaactcttgctccaactggattacatattggtggtactaaatatatggtgattcaaggtgaacctggagctgtcattcgagggaagaaggtatatact |
43055585 |
T |
 |
| Q |
201 |
gttgcttctc |
210 |
Q |
| |
|
|||||||||| |
|
|
| T |
43055586 |
gttgcttctc |
43055595 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 280 - 315
Target Start/End: Original strand, 43055649 - 43055684
Alignment:
| Q |
280 |
atgctatgctatgctatagtaaagataatcatatat |
315 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
43055649 |
atgctatgctatgctatagtaaagataatcatatat |
43055684 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 32; Significance: 0.000000007; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 147 - 194
Target Start/End: Complemental strand, 34173108 - 34173061
Alignment:
| Q |
147 |
atggtgattcaaggtgaacctggagctgtcattcgagggaagaaggta |
194 |
Q |
| |
|
||||| |||||||| || ||||||||||||||||| |||||||||||| |
|
|
| T |
34173108 |
atggttattcaaggagagcctggagctgtcattcgtgggaagaaggta |
34173061 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University