View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7296_low_7 (Length: 247)
Name: NF7296_low_7
Description: NF7296
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7296_low_7 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 158; Significance: 3e-84; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 158; E-Value: 3e-84
Query Start/End: Original strand, 24 - 229
Target Start/End: Complemental strand, 41523107 - 41522904
Alignment:
| Q |
24 |
agaccatcttttagatattaactattatttattaaacactagtaaacctgtannnnnnnaggaagatttctttttcctccacagatatctaagcaattgt |
123 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41523107 |
agaccatcttttagatattaactattatttattaaacactagtaatcctgtatttttttaggaagatttctttttcctccacagatatctaagcaattgt |
41523008 |
T |
 |
| Q |
124 |
ctctttgtattttatattactaataaatctgatgtaaacatctaactgaatatataattatgctttggtctgactgcttaaaatgaagtccattaggata |
223 |
Q |
| |
|
||||||||||||||||||||||| |||| ||||||||||||||||||||| ||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
41523007 |
ctctttgtattttatattactaaaaaatgtgatgtaaacatctaactgaa--tataattatgctttgatctgactgcttaaaatgaagtccattaggata |
41522910 |
T |
 |
| Q |
224 |
tgctac |
229 |
Q |
| |
|
|||||| |
|
|
| T |
41522909 |
tgctac |
41522904 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University