View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF7297_high_10 (Length: 381)

Name: NF7297_high_10
Description: NF7297
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF7297_high_10
NF7297_high_10
[»] chr1 (3 HSPs)
chr1 (6-156)||(52359275-52359423)
chr1 (8-94)||(35661541-35661627)
chr1 (115-184)||(35661443-35661511)


Alignment Details
Target: chr1 (Bit Score: 119; Significance: 1e-60; HSPs: 3)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 119; E-Value: 1e-60
Query Start/End: Original strand, 6 - 156
Target Start/End: Original strand, 52359275 - 52359423
Alignment:
6 aggtttctcgaccaggaacatcgctgcggtcgatgacagaggagactttatcggcttgaatctcaacagagagggattcatattcggtgttgactttagt 105  Q
    |||||||||||||||||||||||| |||||||||||||||||||| |||||||||| ||||||||||||||||||||||||||||||||||||||| |||    
52359275 aggtttctcgaccaggaacatcgcggcggtcgatgacagaggagattttatcggct-gaatctcaacagagagggattcatattcggtgttgacttcagt 52359373  T
106 gaatttagagatggtggagatgagacggcgggagggaggcgtgctcgagat 156  Q
    ||||||||||| ||||||||||||||||| |||||||||||||||||||||    
52359374 gaatttagagacggtggagatgagacggc-ggagggaggcgtgctcgagat 52359423  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 8 - 94
Target Start/End: Complemental strand, 35661627 - 35661541
Alignment:
8 gtttctcgaccaggaacatcgctgcggtcgatgacagaggagactttatcggcttgaatctcaacagagagggattcatattcggtg 94  Q
    ||||||||||| |||||||||| |||||||||||| ||||||| || |||||||||||||||  | ||||| |||||  ||||||||    
35661627 gtttctcgaccgggaacatcgcggcggtcgatgacggaggagatttgatcggcttgaatctcggcggagagagattcggattcggtg 35661541  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #3
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 115 - 184
Target Start/End: Complemental strand, 35661511 - 35661443
Alignment:
115 gatggtggagatgagacggcgggagggaggcgtgctcgagatttaagactgccacgcgtgcaggactgtg 184  Q
    |||||||||||||||||| ||| ||||||||||| ||| | |||||||| |||||| |||||||||||||    
35661511 gatggtggagatgagacgacgg-agggaggcgtggtcgcggtttaagacagccacgtgtgcaggactgtg 35661443  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University