View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7297_high_10 (Length: 381)
Name: NF7297_high_10
Description: NF7297
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7297_high_10 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 119; Significance: 1e-60; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 119; E-Value: 1e-60
Query Start/End: Original strand, 6 - 156
Target Start/End: Original strand, 52359275 - 52359423
Alignment:
| Q |
6 |
aggtttctcgaccaggaacatcgctgcggtcgatgacagaggagactttatcggcttgaatctcaacagagagggattcatattcggtgttgactttagt |
105 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||| |||||||||| ||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
52359275 |
aggtttctcgaccaggaacatcgcggcggtcgatgacagaggagattttatcggct-gaatctcaacagagagggattcatattcggtgttgacttcagt |
52359373 |
T |
 |
| Q |
106 |
gaatttagagatggtggagatgagacggcgggagggaggcgtgctcgagat |
156 |
Q |
| |
|
||||||||||| ||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
52359374 |
gaatttagagacggtggagatgagacggc-ggagggaggcgtgctcgagat |
52359423 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 8 - 94
Target Start/End: Complemental strand, 35661627 - 35661541
Alignment:
| Q |
8 |
gtttctcgaccaggaacatcgctgcggtcgatgacagaggagactttatcggcttgaatctcaacagagagggattcatattcggtg |
94 |
Q |
| |
|
||||||||||| |||||||||| |||||||||||| ||||||| || ||||||||||||||| | ||||| ||||| |||||||| |
|
|
| T |
35661627 |
gtttctcgaccgggaacatcgcggcggtcgatgacggaggagatttgatcggcttgaatctcggcggagagagattcggattcggtg |
35661541 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 115 - 184
Target Start/End: Complemental strand, 35661511 - 35661443
Alignment:
| Q |
115 |
gatggtggagatgagacggcgggagggaggcgtgctcgagatttaagactgccacgcgtgcaggactgtg |
184 |
Q |
| |
|
|||||||||||||||||| ||| ||||||||||| ||| | |||||||| |||||| ||||||||||||| |
|
|
| T |
35661511 |
gatggtggagatgagacgacgg-agggaggcgtggtcgcggtttaagacagccacgtgtgcaggactgtg |
35661443 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University