View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7297_high_12 (Length: 371)
Name: NF7297_high_12
Description: NF7297
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7297_high_12 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 153; Significance: 5e-81; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 153; E-Value: 5e-81
Query Start/End: Original strand, 184 - 352
Target Start/End: Complemental strand, 27085135 - 27084967
Alignment:
| Q |
184 |
ttataaggatcaaaacatgtcaatatgttatgaggattaaaaataaattgattatatttacatggacaaaaaacctatttaaccctgatataaatattga |
283 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
27085135 |
ttataaggatcaaaacatgtcaatattttatgaggattaaaaataaattgattatatttatatggacaaaaaacctatttaaccctgatataaataatga |
27085036 |
T |
 |
| Q |
284 |
gtctgccgcaatgattttgcaaaggaatctcatctccaaccgccgtttgcactctcttcttctgctttc |
352 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27085035 |
gtctgccgcattgattttgcaaaggaatctcatctccaaccgccgtttgcactctcttcttctgctttc |
27084967 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 47; E-Value: 9e-18
Query Start/End: Original strand, 41 - 91
Target Start/End: Complemental strand, 27085278 - 27085228
Alignment:
| Q |
41 |
gttgagcaaattttgaccttaaaatctttttatattgatttaaataagtct |
91 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27085278 |
gttgagctaattttgaccttaaaatctttttatattgatttaaataagtct |
27085228 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 300 - 352
Target Start/End: Complemental strand, 27718008 - 27717956
Alignment:
| Q |
300 |
ttgcaaaggaatctcatctccaaccgccgtttgcactctcttcttctgctttc |
352 |
Q |
| |
|
|||||||| ||||| ||||||||||||| |||||||| ||||| | ||||||| |
|
|
| T |
27718008 |
ttgcaaagcaatctaatctccaaccgccatttgcactttcttcctttgctttc |
27717956 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 31; Significance: 0.00000003; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 211 - 268
Target Start/End: Complemental strand, 40374698 - 40374640
Alignment:
| Q |
211 |
ttatgaggattaaaaat-aaattgattatatttacatggacaaaaaacctatttaaccc |
268 |
Q |
| |
|
||||||||| |||||| |||||||||||||||| | ||||||||||| |||||||||| |
|
|
| T |
40374698 |
ttatgaggactaaaaacgaaattgattatatttatagggacaaaaaacttatttaaccc |
40374640 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 184 - 268
Target Start/End: Original strand, 42209549 - 42209634
Alignment:
| Q |
184 |
ttataaggatcaaaacatgtcaatatgttatgaggattaaaaataaa-ttgattatatttacatggacaaaaaacctatttaaccc |
268 |
Q |
| |
|
||||| ||| |||||||||||| | | ||||||||| |||||| ||| |||| ||||||| |||||||||||| |||||||||| |
|
|
| T |
42209549 |
ttatagggaccaaaacatgtcacttttttatgaggactaaaaacaaaattgactatatttttatggacaaaaaaattatttaaccc |
42209634 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University