View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7297_low_16 (Length: 278)
Name: NF7297_low_16
Description: NF7297
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7297_low_16 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 146; Significance: 6e-77; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 146; E-Value: 6e-77
Query Start/End: Original strand, 105 - 265
Target Start/End: Original strand, 44739995 - 44740156
Alignment:
| Q |
105 |
gttatgagtgtgtttggaatgagtgatttaggagctagagatggtgaagaaagaaagaaagggaaaaaataaatgatgatatagctcattggctcgccaa |
204 |
Q |
| |
|
|||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44739995 |
gttacgagtctgtttggaatgagtgatttaggagctagagatggtgaagaaagaaagaaagggaaaaaataaatgatgatatagctcattggctcgccaa |
44740094 |
T |
 |
| Q |
205 |
tagattaaaacaattttcacggggcacatg-ttttttccaaaattcgacacaactcttttct |
265 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
44740095 |
tagattaaaacaattttcacggggcacatgtttttttccaaaattcgacacaactcttttct |
44740156 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 106; E-Value: 4e-53
Query Start/End: Original strand, 1 - 110
Target Start/End: Original strand, 44739857 - 44739966
Alignment:
| Q |
1 |
cgaaattgcaaatcatcacttcttgtcttattggaccttaaagtttaattatttaactctgatcattttcaaataattaacaaaagctacaatgagtttg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44739857 |
cgaaattgcaaatcatcacttcttgtcttattggaccttaaagtttcattatttaactctgatcattttcaaataattaacaaaagctacaatgagtttg |
44739956 |
T |
 |
| Q |
101 |
ttaggttatg |
110 |
Q |
| |
|
|||||||||| |
|
|
| T |
44739957 |
ttaggttatg |
44739966 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University