View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7297_low_6 (Length: 447)
Name: NF7297_low_6
Description: NF7297
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7297_low_6 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 105; Significance: 3e-52; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 105; E-Value: 3e-52
Query Start/End: Original strand, 23 - 131
Target Start/End: Original strand, 19308611 - 19308719
Alignment:
| Q |
23 |
aggaccataatatatgcactatcaactttggattttacatgtttcagtaaaatatcgaaaaaatctacgcattgatagattggaactaaaattttcaaaa |
122 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19308611 |
aggaccataatatatgcactatcaactttggattttacatgtttcagtaaaaaatcgaaaaaatctacgcattgatagattggaactaaaattttcaaaa |
19308710 |
T |
 |
| Q |
123 |
gcactctat |
131 |
Q |
| |
|
||||||||| |
|
|
| T |
19308711 |
gcactctat |
19308719 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 372 - 435
Target Start/End: Original strand, 19308744 - 19308807
Alignment:
| Q |
372 |
caatactagaagaagaatacctagcaggaatacatgaatgtaaacataaccttcatggcagaat |
435 |
Q |
| |
|
|||||| ||||||||||||||||||||||||| ||||||||||||||||||||||||| ||||| |
|
|
| T |
19308744 |
caataccagaagaagaatacctagcaggaatagatgaatgtaaacataaccttcatggtagaat |
19308807 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University