View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7298_low_5 (Length: 268)
Name: NF7298_low_5
Description: NF7298
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7298_low_5 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 90; Significance: 1e-43; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 90; E-Value: 1e-43
Query Start/End: Original strand, 140 - 237
Target Start/End: Original strand, 32826639 - 32826736
Alignment:
| Q |
140 |
actatcgactggtgttgggtccatttgttgggtgtgtgcgcactttccttcaacgcttcgttattttggccaatgtttttcttaaccgagtcgtgctc |
237 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32826639 |
actatcgactggtgttgggtccatttgttgggtgtatgcgcactttccttcaacgcttcattattttggccaatgtttttcttaaccgagtcgtgctc |
32826736 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University