View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7298_low_8 (Length: 216)
Name: NF7298_low_8
Description: NF7298
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7298_low_8 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 141; Significance: 4e-74; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 141; E-Value: 4e-74
Query Start/End: Original strand, 3 - 194
Target Start/End: Original strand, 13286316 - 13286510
Alignment:
| Q |
3 |
gttgtttgtttatttgtgctttattgagttgtttgtttatatatgcaaatgctg----ggtaggaagctttgttacttgattaaaacgcaattggacttt |
98 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
13286316 |
gttgtttgtttatttgtgctttattgagttgtttgtttatatatgcaaatgctggctgggtaggaagctttgttacttgattataacgcaattggacttt |
13286415 |
T |
 |
| Q |
99 |
aggtcttgctattatggctagtgctatatatannnnnnnggggttattcactcaagacacatcagcaaattctttctttctcactcaaatcctctt |
194 |
Q |
| |
|
||||||||||||||| |||||||||||||||| ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
13286416 |
aggtcttgctattatagctagtgctatatata-ttttttggggttattcactcaagacacatcagcaaattccttctttctcactcaaatcctctt |
13286510 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University