View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF7299_high_15 (Length: 232)

Name: NF7299_high_15
Description: NF7299
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF7299_high_15
NF7299_high_15
[»] chr3 (2 HSPs)
chr3 (17-96)||(32902681-32902760)
chr3 (154-221)||(32903075-32903142)


Alignment Details
Target: chr3 (Bit Score: 64; Significance: 4e-28; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 64; E-Value: 4e-28
Query Start/End: Original strand, 17 - 96
Target Start/End: Original strand, 32902681 - 32902760
Alignment:
17 actaataactactataatttccttttattctgcaattctaactgagaatggatggtttaggggatattggtcaaattgtg 96  Q
    ||||||| ||||||||||||||||||||| ||||||| |||| |||||||||||||||||||||||||||||||||||||    
32902681 actaatagctactataatttccttttattttgcaattataacagagaatggatggtttaggggatattggtcaaattgtg 32902760  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 64; E-Value: 4e-28
Query Start/End: Original strand, 154 - 221
Target Start/End: Original strand, 32903075 - 32903142
Alignment:
154 ataagaatgttcattctacatataacttggaatagactattgttgtggttattagtattgatgtccat 221  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||    
32903075 ataagaatgttcattctacatataacttggaatagactattgttgtggttattagtattgatggccat 32903142  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University