View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7299_low_15 (Length: 252)
Name: NF7299_low_15
Description: NF7299
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7299_low_15 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 132; Significance: 1e-68; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 132; E-Value: 1e-68
Query Start/End: Original strand, 38 - 238
Target Start/End: Original strand, 12173569 - 12173770
Alignment:
| Q |
38 |
tggatacagggatgagggatacttttaattagtttatagaaggtgtgcgtaaggtaatcaagagtgatcttacacttcattctgggacgatacctaagtg |
137 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |||| |
|
|
| T |
12173569 |
tggatacaaggatgagggatacttttaattagtttataaaaggtgtgcgtaaggtaatcaagagtgatcttacacttcattttgggacgatacctgagtg |
12173668 |
T |
|
| Q |
138 |
ggcttgctccccattat--ggggagttgttaatagttttaaagggacattcgttgtctgacaggtgacaattcttgaatttgaaaacatagcttagaggg |
235 |
Q |
| |
|
||||||||||| ||||| || |||||||| ||||||||||||||| |||||| || ||||||| ||||| ||||||||||||||||||||| |||||| |
|
|
| T |
12173669 |
ggcttgctccctattatgaggagagttgttgatagttttaaagggatgttcgttatc-gacaggtaacaatacttgaatttgaaaacatagctcagaggg |
12173767 |
T |
|
| Q |
236 |
gtt |
238 |
Q |
| |
|
||| |
|
|
| T |
12173768 |
gtt |
12173770 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University