View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7299_low_20 (Length: 232)
Name: NF7299_low_20
Description: NF7299
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7299_low_20 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 64; Significance: 4e-28; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 64; E-Value: 4e-28
Query Start/End: Original strand, 17 - 96
Target Start/End: Original strand, 32902681 - 32902760
Alignment:
| Q |
17 |
actaataactactataatttccttttattctgcaattctaactgagaatggatggtttaggggatattggtcaaattgtg |
96 |
Q |
| |
|
||||||| ||||||||||||||||||||| ||||||| |||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32902681 |
actaatagctactataatttccttttattttgcaattataacagagaatggatggtttaggggatattggtcaaattgtg |
32902760 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 64; E-Value: 4e-28
Query Start/End: Original strand, 154 - 221
Target Start/End: Original strand, 32903075 - 32903142
Alignment:
| Q |
154 |
ataagaatgttcattctacatataacttggaatagactattgttgtggttattagtattgatgtccat |
221 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
32903075 |
ataagaatgttcattctacatataacttggaatagactattgttgtggttattagtattgatggccat |
32903142 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University