View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7300_high_11 (Length: 264)
Name: NF7300_high_11
Description: NF7300
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7300_high_11 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 229; Significance: 1e-126; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 229; E-Value: 1e-126
Query Start/End: Original strand, 20 - 248
Target Start/End: Complemental strand, 43665471 - 43665243
Alignment:
| Q |
20 |
taaccgacgaagacggtaacgttacaaagagtagtaacccatgtttcggggaattatccggtgcttttcgcgaactaaagcgtcccatgtggatcttact |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43665471 |
taaccgacgaagacggtaacgttacaaagagtagtaacccatgtttcggggaattatccggtgcttttcgcgaactaaagcgtcccatgtggatcttact |
43665372 |
T |
|
| Q |
120 |
attggtgacgtgtctcaactggattgcgtggtttcctttcttactattcgatactgattggatggggaaagaggtttatggaggaacggttggggaaggt |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43665371 |
attggtgacgtgtctcaactggattgcgtggtttcctttcttactattcgatactgattggatggggaaagaggtttatggaggaacggttggggaaggt |
43665272 |
T |
|
| Q |
220 |
catgcgtatgataaaggtgtgcgcgcggg |
248 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
43665271 |
catgcgtatgataaaggtgtgcgcgcggg |
43665243 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University