View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF7300_low_10 (Length: 401)
Name: NF7300_low_10
Description: NF7300
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF7300_low_10 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 52; Significance: 1e-20; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 317 - 388
Target Start/End: Complemental strand, 9439508 - 9439437
Alignment:
| Q |
317 |
gagggaatatctggtctaaaattcttttcaggtgaaccttcattaaattatccttgtgtagatctcattcat |
388 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||| ||||| || |||| |||||||||||||| |
|
|
| T |
9439508 |
gagggaatatctggtctaaaattcttttcaggcgaaccttcatcaaattctcattgtatagatctcattcat |
9439437 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 133 - 262
Target Start/End: Complemental strand, 9439651 - 9439522
Alignment:
| Q |
133 |
tatttggatagtaaccaaatggaatgagaaaaccagaggttactcttcagagtcagagacaccactttttatccttaaatctaatgtaacagatcatctt |
232 |
Q |
| |
|
|||||||||||||| |||| || | |||||||||||||||||||| |||||||||| ||| || ||| |||||||||||| | | | ||||| |||| |
|
|
| T |
9439651 |
tatttggatagtaagcaaaaggtagaagaaaaccagaggttactctgcagagtcagatacaacattttctatccttaaatccattaggatagatcctctt |
9439552 |
T |
|
| Q |
233 |
cctctctcccactttcttctcataattctt |
262 |
Q |
| |
|
|| |||||||||||||||| ||||||||| |
|
|
| T |
9439551 |
ccactctcccactttcttcatataattctt |
9439522 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University